Research Article

Mitochondrial DNA Profiling in A Cohort of Antiretroviral Treated HIV Patients in Lagos, Nigeria: Assessment of Long-Term Effects of cART on Life Quality of PLWH

Azuka Patrick Okwuraiwe
Nigerian Institute of Medical Research, Nigeria
* Corresponding author
Rahaman A. Ahmed
Nigerian Institute of Medical Research, Nigeria
Disu Tajudeen
Nigerian Institute of Medical Research, Nigeria
Stephnie Nwaiwu
Nigerian Institute of Medical Research, Nigeria
Patrick Irurhe
Nigerian Institute of Medical Research, Nigeria
Rosemary Ajuma Audu
Nigerian Institute of Medical Research, Nigeria
Chika Kingsley Onwuamah
Nigerian Institute of Medical Research, Nigeria
DOI icon 10.24018/ejmed.2022.4.3.1243

Read Counter
722

Downloads
443

Citations

Share

Article Sidebar

Submitted 2022-02-15
Published 2022-06-23

Read counter = 722 times

Table of Contents

Article Main Content

The use of combined antiretroviral therapy (cART) has turned HIV infection to a manageable condition, significantly reducing HIV-related morbidity and mortality globally. Risk of transmission has been substantially reduced in Africa where 67% of global infection is domiciled. However, long-term impact of cART on life quality of HIV patients elicits concern due to possible oxidative stress stimulus and accumulated toxicity. Mitochondrion, responsible for molecular metabolism in eukaryotes has been proposed as a marker for cellular dysfunction and ageing. Metabolic dysfunction due to accumulated oxidative stress may lead to mitochondrial DNA (mtDNA) mutation, protein alteration, and premature apoptosis leading to ageing.

A cohort study comprising of 302 HIV infected persons receiving cART (Tenofovir, Lamivudine, Dolutegravir; TLD) at NIMR HIV reference clinic, and 113 healthy controls. Venous blood was collected in vacutainer tubes and plasma isolated. DNA extraction was done using NIMR-Biotech DNA Extraction kit, and mtDNA levels measured using SYBRGreen dye-based quantitative real-time PCR assay on Quant Studio 5. Primer sequences from human 12S ribosomal RNA with CCACGGGAAACAGCAGTGAT and CTATTGACTTGGGTTAATCGTGTGA as forward and reverse sequences respectively were used to amplify mtDNA locus. Melting curve was performed for every run to confirm successful amplification of targeted region. Total DNA from an immortalized Hela cell line, diluted in 10-fold serial dilutions, was used as standard curve. Plasma mtDNA levels were evaluated and data analyzed using IBM SPSS software (version 24).

Among HIV infected individuals, 185 (88.1%) were female and mean age was 32±0.43 years while 36 (32%) and 27±0.57 years were female and mean age among controls, respectively. Mean CD4 count among HIV subjects was 427±29 cells/µl while 62.4% had less than 50 viral copies/ml. Majority of subjects (74.9%) were on first line cART while mean exposure to ART regimens was 4±0.3 years. No significant difference was observed between mtDNA concentration of HIV subjects (mean = 256±38 copies/µl) and healthy controls (mean: 247±72 copies/µl), neither among only HIV subjects, when stratified based on viral load or CD4 count.

No association was observed between cell free (cf)-mtDNA and cART exposure among HIV patients. Lack of baseline information on initial cf-mtDNA among Africans was challenging in establishing that new ART regimens had enhanced recovery from mitochondrial-DAMP. There is need to continuously assess prolonged effect of cART to ensure good quality of life and healthy ageing for people living with HIV (PLWH).

Keywords: cART, HIV, mitochondrial DNA, PLWH

References

  1. Bekker LG, Venter F, Cohen K, Goemare E, Van Cutsem G, Boulle A, et al. Provision of antiretroviral therapy in South Africa: the nuts and bolts. Antiviral Therapy. 2014; 19 Suppl 3: 105-116.
     Google Scholar
  2. Deeks SG, Lewin SR, Havlir DV. The end of AIDS: HIV infection as a chronic disease. Lancet. 2013; 382(9903): 1525–1533.
     Google Scholar
  3. World Health Organization. Consolidated guidelines on the use of antiretroviral drugs for treating and preventing HIV infection: Recommendations for a public health approach. 2nd ed., [Internet] 2016. [updated 2016 Jan 23; cited 2016 Feb 6]. Available from: https://apps.who.int/iris/handle/10665/208825.
     Google Scholar
  4. Matsui Y, Takaori-Kondo A. Progress in Antiretroviral Therapy and HAND. Brain Nerve. 2015; 67(7): 947–959.
     Google Scholar
  5. Troya J, Bascuñana J. Safety and Tolerability: Current Challenges to Antiretroviral Therapy for the Long-Term Management of HIV Infection. AIDS Reviews. 2016; 18(3): 127–137.
     Google Scholar
  6. Vos AG, Venter WDF. Cardiovascular toxicity of contemporary antiretroviral therapy. Current Opinion in HIV and AIDS. 2021; 16(6): 286–291.
     Google Scholar
  7. Global HIV AIDS statistics—2020 fact sheet. (n.d.). [Internet] [updated 2020 Jun 23; Cited December 12, 2020]. Available from http://www.unaids.org/en/resources/fact-sheet
     Google Scholar
  8. Gonçalves VF. Mitochondrial Genetics. Advances in Experimental Medicine and Biology. 2019; 1158: 247–255.
     Google Scholar
  9. Friedman JR, Nunnari J. Mitochondrial form and function. Nature. 2014; 505(7483): 335–343.
     Google Scholar
  10. Ganta KK, Chaubey B. Endoplasmic reticulum stress leads to mitochondria-mediated apoptosis in cells treated with anti-HIV protease inhibitor ritonavir. Cell Biology and Toxicology. 2019; 35(3): 189–204.
     Google Scholar
  11. Duvvuri B, Lood C. Cell-Free DNA as a Biomarker in Autoimmune Rheumatic Diseases. Frontiers in Immunology. 2019; 10: 502.
     Google Scholar
  12. Hunt M, Payne BAI. Mitochondria and ageing with HIV. Current Opinions in HIV and AIDS. 2020; 15(2): 101–109.
     Google Scholar
  13. Liu F, Sanin DE, Wang X. Mitochondrial DNA in Lung Cancer. Advances in Experimental Medicine and Biology. 2017; 1038: 9–22.
     Google Scholar
  14. Stefano GB, Kream RM. Mitochondrial DNA heteroplasmy in human health and disease. Biomedical Reports. 2016; 4(3): 259–262.
     Google Scholar
  15. Yan C, Duanmu X, Zeng L, Liu B, Song Z. Mitochondrial DNA: Distribution, Mutations, and Elimination. Cells. 2019; 8(4): 379.
     Google Scholar
  16. Rubartelli A, Lotze MT. Inside, outside, upside down: Damage-associated molecular-pattern molecules (DAMPs) and redox. Trends in Immunology. 2007; 28(10): 429–436.
     Google Scholar
  17. Seong SY, Matzinger P. Hydrophobicity: An ancient damage-associated molecular pattern that initiates innate immune responses. Natural Reviews in Immunology. 2004; 4(6): 469–478.
     Google Scholar
  18. Frank MO. Circulating Cell-Free DNA Differentiates Severity of Inflammation. Biological Research for Nursing. 2016; 18(5): 477–488.
     Google Scholar
  19. Gambardella S, Limanaqi F, Ferese R, Biagioni F, Campopiano R, Centonze D, et al. ccf-mtDNA as a Potential Link Between the Brain and Immune System in Neuro-Immunological Disorders. Frontiers in Immunology. 2019; 10: 1064.
     Google Scholar
  20. Gravina S, Sedivy JM, Vijg J. The dark side of circulating nucleic acids. Aging Cell. 2016; 15(3): 398–399.
     Google Scholar
  21. Wang L, Zhou W, Wang K, He S, Chen Y. Predictive value of circulating plasma mitochondrial DNA for Sepsis in the emergency department: Observational study based on the Sepsis-3 definition. BMC Emergency Medicine. 2020; 20(1): 1–7.
     Google Scholar
  22. Pernas B, Rego-Pérez I, Tabernilla A, Balboa V, Relaño S, Grandal M, et al. Plasma mitochondrial DNA levels are inversely associated with HIV-RNA levels and directly with CD4 counts: Potential role as a biomarker of HIV replication. Journal of Antimicrobial Chemotherapy. 2017; 72(11): 3159–3162.
     Google Scholar
  23. Koczor CA, Lewis W. Nucleoside reverse transcriptase inhibitor toxicity and mitochondrial DNA. Expert Opinion on Drug Metabolism and Toxicology. 2010; 6(12): 1493–1504.
     Google Scholar
  24. Barroso S, Morén C, González-Segura A, Riba N, Arnaiz JA, Manriquez M, et al. Metabolic, mitochondrial, renal and hepatic safety of enfuvirtide and raltegravir antiretroviral administration: Randomized crossover clinical trial in healthy volunteers. PloS One. 2019; May 23, 14(5): e0216712.
     Google Scholar
  25. Gratton R, Tricarico PM, Guimaraes RL, Celsi F, Crovella S. Lopinavir/Ritonavir Treatment Induces Oxidative Stress and Caspase independent Apoptosis in Human Glioblastoma U-87 MG Cell Line. Current HIV Research. 2018; 16(2): 106–112.
     Google Scholar
  26. Yuzefovych LV, Pastukh VM, Ruchko MV, Simmons JD, Richards WO, Rachek LI. Plasma mitochondrial DNA is elevated in obese type 2 diabetes mellitus patients and correlates positively with insulin resistance. PLoS One. 2019; 14(10): e0222278.
     Google Scholar
  27. Birkus G, Hitchcock MJM, Cihlar T. Assessment of mitochondrial toxicity in human cells treated with tenofovir: Comparison with other nucleoside reverse transcriptase inhibitors. Antimicrobial Agents and Chemotherapy. 2002; 46(3): 716–723.
     Google Scholar
  28. Kanters S, Vitoria M, Doherty M, Socias ME, Ford N, Forrest JI, et al. Comparative efficacy and safety of first-line antiretroviral therapy for the treatment of HIV infection: A systematic review and network meta-analysis. Lancet HIV. 2016; 3(11): e510–e520.
     Google Scholar
  29. Pérez-Santiago J, De Oliveira MF, Var SR, Day TRC, Woods SP, Gianella S, et al. Increased cell-free mitochondrial DNA is a marker of ongoing inflammation and better neurocognitive function in virologically suppressed HIV-infected individuals. Journal of Neurovirology. 2017; 23(2): 283–289.
     Google Scholar
  30. Arshad O, Gadawska I, Sattha B, Côté HCF, Hsieh AYY. Canadian Institutes of Health Research Team on Cellular Aging and HIV Comorbidities in Women and Children (CARMA). Elevated Cell-Free Mitochondrial DNA in Filtered Plasma Is Associated with HIV Infection and Inflammation. Journal of Acquired Immune Deficiency Syndrome. 2018; May 1;78(1): 111-118.
     Google Scholar
  31. Cossarizza A, Pinti M, Nasi M, Gibellini L, Manzini S, Roat E, et al. Increased plasma levels of extracellular mitochondrial DNA during HIV infection: A new role for mitochondrial damage-associated molecular patterns during inflammation. Mitochondrion. 2011; 11(5): 750–755.
     Google Scholar
  32. Cossarizza A, Pinti M, Moretti L, Bricalli D, Bianchi R, Troiano L, et al. Mitochondrial Functionality and Mitochondrial DNA Content in Lymphocytes of Vertically Infected Human Immunodeficiency Virus—Positive Children with Highly Active Antiretroviral Therapy—Related Lipodystrophy. Journal of Infectious Diseases. 2002; 185(3): 299–305.
     Google Scholar
  33. Dai Z, Cai W, Hu F, Lan Y, Li L, Chung C, et al. Plasma Mitochondrial DNA Levels as a Biomarker of Lipodystrophy Among HIV-infected Patients Treated with Highly Active Antiretroviral Therapy (HAART). Current Molecular Medicine. 2015; 15(10): 975–979.
     Google Scholar
  34. Lauring AS, Lee TH, Martin JN, Hunt PW, Deeks SG, Busch M. Lack of evidence for mtDNA as a biomarker of innate immune activation in HIV infection. PLoS One. 2012; 7(11): e50486.
     Google Scholar
  35. Ikekpeazu JE, Orji OC, Uchendu IK, Ezeanyika LUS. Mitochondrial and Oxidative Impacts of Short and Long-term Administration of HAART on HIV Patients. Current Clinical Pharmacology. 2020; 14(2): 110–124.
     Google Scholar
  36. Jao J, Powis KM, Kirmse B, Yu C, Epie F, Nshom E, et al. Lower mitochondrial DNA and altered mitochondrial fuel metabolism in HIV-exposed uninfected infants in Cameroon. AIDS. 2017; 31(18): 2475–2481.
     Google Scholar
  37. Kampira E, Dzobo K, Kumwenda J, van Oosterhout, JJ, Parker MI, Dandara C. Peripheral blood mitochondrial DNA/nuclear DNA (mtDNA/nDNA) ratio as a marker of mitochondrial toxicities of stavudine containing antiretroviral therapy in HIV-infected Malawian patients. OMICS. 2014; 18(7): 438–445.
     Google Scholar
  38. Kunz A, von Wurmb-Schwark N, Sewangi J, Ziske J, Lau I, Mbezi P, et al. Zidovudine exposure in HIV-1 infected Tanzanian women increases mitochondrial DNA levels in placenta and umbilical cords. PloS One. 2012; 7(7): e41637.
     Google Scholar
  39. Menezes C, Duarte R, Dickens C, Dix-Peek T, Van Amsterdam D, John M, et al. The early effects of stavudine compared with tenofovir on adipocyte gene expression, mitochondrial DNA copy number and metabolic parameters in South African HIV-infected patients: A randomized trial. HIV Medicine. 2013; 14(4): 217–225.
     Google Scholar
  40. Monnin A, Nagot N, Periès, Vallo R, Meda N, Singata-Madliki, M, et al. Mitochondrial DNA Parameters in Blood of Infants Receiving Lopinavir/Ritonavir or Lamivudine Prophylaxis to Prevent Breastfeeding Transmission of HIV-1. Journal of Clinical Medicine. 2020; 9(9): 2972.
     Google Scholar
  41. Shen J, Liberty A, Shiau S, Strehlau R, Pierson S, Patel F, et al. Mitochondrial Impairment in Well-Suppressed Children with Perinatal HIV-Infection on Antiretroviral Therapy. AIDS Research and Human Retroviruses. 2020; 36(1): 27–38.
     Google Scholar
  42. Noguera-Julian A, Morén C, Rovira N, Garrabou G, Catalán M, Sánchez E, et al. Decreased Mitochondrial Function Among Healthy Infants Exposed to Antiretrovirals During Gestation, Delivery and the Neonatal Period. The Pediatric Infectious Disease Journal. 2015; 34(12): 1349–1354.
     Google Scholar
  43. Sun J, Longchamps RJ, Piggott DA, Castellani CA, Sumpter JA, Brown TT, et al. Association Between HIV Infection and Mitochondrial DNA Copy Number in Peripheral Blood: A Population-Based, Prospective Cohort Study. Journal of Infectious Diseases. 2019; 219(8): 1285–1293.
     Google Scholar
  44. McComsey GA, Paulsen DM, Lonergan JT, Hessenthaler SM, Hoppel CL, Williams V, et al. Improvements in lipoatrophy, mitochondrial DNA levels and fat apoptosis after replacing stavudine with abacavir or zidovudine. AIDS. 2005; 19(1): 15–23.
     Google Scholar


Most read articles by the same author(s)